Search Query :
1IE1
Nmr solution structure of an in vitro selected rna which is sequence specifically recognized by hamster nucleolin rbd12. Deposition Author(s): Allain, F.H.-T. , Bouvet, P. , Dieckmann, T. , Feigon, J. , Finger, L.D.
Date: 2001-04-05 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1IE1_A
1IE2
Solution structure of an in vitro selected rna which is sequence specifically recognized by rbd12 of hamster nucleolin.snre (anti) Deposition Author(s): Allain, F.H.-T. , Bouvet, P. , Dieckmann, T. , Feigon, J. , Finger, L.D.
Date: 2001-04-05 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1IE2_A
1NA2
Solution structure of the p2b hairpin from human telomerase rna Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A. , Trantirek, L.
Date: 2002-11-26 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1NA2_A
1Q75
Solution structure of the dyskeratosis congenita mutant p2b hairpin from human telomerase rna Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A.
Date: 2003-08-15 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1Q75_A
1QWA
Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12. Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWA_A
1QWB
Nmr structure of 5'-r(ggacacgaaaucccgaaguagugucc)-3' : an rna hairpin containing the in vitro selected consensus sequence for nucleolin rbd12 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWB_A
1RKJ
Solution structure of the complex formed by the two n-terminal rna-binding domains of nucleolin and a pre-rrna target Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Kim, S. , Laird-Offringa, I.A. , Mueller, T.D. , Trantirek, L.
Date: 2003-11-21 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mesocricetus Auratus , Synthetic Construct Sequences Data: 1RKJ_B , 1RKJ_A
5FV7
Human fen1 in complex with an n-hydroxyurea compound Deposition Author(s): Abbott, W.M. , Debreczeni, J.E. , Durant, S.T. , Exell, J.C. , Finger, L.D. , Grasby, J.A. , Jones, C.D. , Mcwhirter, C. , Molina, D.M. , Nissink, J.W.M. , Shaw, S.K. , Sioberg, C.W.L. , Thompson, M.J. , Ward, T.A.
Date: 2016-02-03 Method: X-RAY DIFFRACTION Resolution: 2.84 Å Organism(s): Homo Sapiens Sequences Data: 5FV7_A , 5FV7_B