Crystal structure of fis bound to 27bp inosine substituted dna f29-di (aaatttgtttgiicictgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.9 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHY_A , 4IHY_B , 4IHY_C , 4IHY_D
Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.561 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS9_A , 5DS9_B , 5DS9_C , 5DS9_D
Crystal structure of fis bound to 27bp dna f1-8c (aaattcgtttgaattttgagcgaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.642 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5DTD_A , 5DTD_B , 5DTD_C , 5DTD_D
Crystal structure of fis bound to 27bp dna f1-8g (aaattggtttgaattttgagccaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3L_A , 5E3L_B , 5E3L_C , 5E3L_D
Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C. , Stella, S.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.886 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3M_A , 5E3M_B , 5E3M_C , 5E3M_D
Crystal structure of fis bound to 27bp dna f31 (aaatttgtaggaattttctgcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3N_A , 5E3N_B , 5E3N_C , 5E3N_D
Crystal structure of fis bound to 27bp dna f32 (aaatttggaggaattttctccaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.78 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3O_A , 5E3O_B , 5E3O_C , 5E3O_D
Crystal structure of the c-terminal catalytic domain of is1535 tnpa, an is607-like serine recombinase Deposition Author(s): Cascio, D. , Chen, W.Y. , Hancock, S.P. , Johnson, R.C.
Date: 2018-05-17 Method: X-RAY DIFFRACTION Resolution: 2.52 Å Organism(s): Mycobacterium Tuberculosis Sequences Data: 6DGB_A , 6DGB_B
Crystal structure of the c-terminal catalytic domain of isc1926 tnpa, an is607-like serine recombinase Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C. , Kumar, P.
Date: 2018-05-17 Method: X-RAY DIFFRACTION Resolution: 2.92 Å Organism(s): Sulfolobus Sp. L00 11 Sequences Data: 6DGC_A , 6DGC_B , 6DGC_C , 6DGC_D
Crystal structure of ternary dna complex "fx2" containing e. coli fis and phage lambda xis Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2019-05-17 Method: X-RAY DIFFRACTION Resolution: 2.7 Å Organism(s): Escherichia Coli , Escherichia Phage Lambda , Synthetic Construct Sequences Data: 6P0S_A , 6P0S_B , 6P0S_C , 6P0S_D , 6P0S_E