Search Query :
3JRD
Crystal structure of fis bound to 27 bp dna f25 containing t2a3 sequence at center Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 3.1 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRD_A , 3JRD_B , 3JRD_C , 3JRD_D
3JRE
Crystal structure of fis bound to 27 bp dna f26 containing a-tract at center Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 3.17 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRE_A , 3JRE_B , 3JRE_C , 3JRE_D
3JRF
Crystal structure of fis bound to 27 bp dna f27 containing a c/g at center Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 3.05 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRF_A , 3JRF_B , 3JRF_C , 3JRF_D
3JRG
Crystal structure of fis bound to 27 bp non consensus sequence dna f18 Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 3.11 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRG_A , 3JRG_B , 3JRG_C , 3JRG_D
3JRH
Crystal structure of fis bound to 27 bp non consensus sequence dna f21 Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 2.88 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRH_A , 3JRH_B , 3JRH_C , 3JRH_D
3JRI
Crystal structure of fis bound to 27 bp non consensus sequence dna f23 Deposition Author(s): Cascio, D. , Johnson, R.C. , Stella, S.
Date: 2009-09-08 Method: X-RAY DIFFRACTION Resolution: 3.11 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 3JRI_A , 3JRI_B , 3JRI_C , 3JRI_D
4FIS
The molecular structure of wild-type and a mutant fis protein: relationship between mutational changes and recombinational enhancer function or dna binding Deposition Author(s): Dickerson, R.E. , Feng, J.-A. , Finkel, S.E. , Johnson, R.C. , Yuan, H.S.
Date: 1991-08-12 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Escherichia Coli Sequences Data: 4FIS_A , 4FIS_B
4IHV
Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.716 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHV_A , 4IHV_B , 4IHV_C , 4IHV_D
4IHW
Crystal structure of fis bound to 27 bp inosine substituted dna f28-di (aaatttgtttgaicittgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.7 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHW_A , 4IHW_B , 4IHW_C , 4IHW_D
4IHX
Crystal structure of fis bound to 27 bp 2-aminopurine substituted dna f28-2ap (aaatttgtttga2t2ttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.8 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 4IHX_A , 4IHX_B , 4IHX_C , 4IHX_D