Search Query :
1PG1
Protegrin 1 (pg1) from porcine leukocytes, nmr, 20 structures Deposition Author(s): Dieckmann, T. , Eisenberg, D. , Fahrner, R.L. , Feigon, J. , Harwig, S.S.L. , Lehrer, R.I.
Date: 1998-03-20 Method: SOLUTION NMR Resolution: N.A. Organism(s): Sus Scrofa Sequences Data: 1PG1_A
1Q75
Solution structure of the dyskeratosis congenita mutant p2b hairpin from human telomerase rna Deposition Author(s): Feigon, J. , Finger, L.D. , Theimer, C.A.
Date: 2003-08-15 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1Q75_A
1QWA
Nmr structure of 5'-r(ggaugccucccgagugcaucc): an rna hairpin derived from the mouse 5'ets that binds nucleolin rbd12. Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWA_A
1QWB
Nmr structure of 5'-r(ggacacgaaaucccgaaguagugucc)-3' : an rna hairpin containing the in vitro selected consensus sequence for nucleolin rbd12 Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Trantirek, L.
Date: 2003-09-01 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1QWB_A
1R3X
Intramolecular dna triplex with rna third strand, nmr, 10 structures Deposition Author(s): Feigon, J. , Gotfredsen, C.H. , Schultze, P.
Date: 1998-02-06 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1R3X_A , 1R3X_B , 1R3X_C
1RAW
Atp binding rna aptamer in complex with amp, nmr, 10 structures Deposition Author(s): Dieckmann, T. , Feigon, J.
Date: 1996-07-17 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1RAW_A
1RKJ
Solution structure of the complex formed by the two n-terminal rna-binding domains of nucleolin and a pre-rrna target Deposition Author(s): Feigon, J. , Finger, L.D. , Johansson, C. , Kim, S. , Laird-Offringa, I.A. , Mueller, T.D. , Trantirek, L.
Date: 2003-11-21 Method: SOLUTION NMR Resolution: N.A. Organism(s): Mesocricetus Auratus , Synthetic Construct Sequences Data: 1RKJ_B , 1RKJ_A
1RVH
Solution structure of the dna dodecamer gcaaaattttgc Deposition Author(s): Feigon, J. , Ravindranathan, S. , Sklenar, V. , Stefl, R. , Wu, H.
Date: 2003-12-13 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1RVH_A , 1RVH_B
1RVI
Solution structure of the dna dodecamer cgttttaaaacg Deposition Author(s): Feigon, J. , Ravindranathan, S. , Sklenar, V. , Stefl, R. , Wu, H.
Date: 2003-12-13 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 1RVI_A , 1RVI_B
1T4L
Solution structure of double-stranded rna binding domain of s. cerevisiae rnase iii (rnt1p) in complex with the 5' terminal rna hairpin of snr47 precursor Deposition Author(s): Chanfreau, G. , Feigon, J. , Henras, A. , Wu, H.
Date: 2004-04-29 Method: SOLUTION NMR Resolution: N.A. Organism(s): Saccharomyces Cerevisiae , Synthetic Construct Sequences Data: 1T4L_A , 1T4L_B