Search Query :
5E3O
Crystal structure of fis bound to 27bp dna f32 (aaatttggaggaattttctccaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.78 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3O_A , 5E3O_B , 5E3O_C , 5E3O_D
5FOY
De novo structure of the binary mosquito larvicide binab at ph 7 Deposition Author(s): Bideshi, D.L. , Boutet, S. , Brewster, A.S. , Brunger, A.T. , Cascio, D. , Colletier, J.P. , Deponte, D.P. , Eisenberg, D.S. , Federici, B.A. , Gingery, M. , Hunter, M.S. , Koglin, J.E. , Laksmono, H. , Messerschmidt, M. , Michels-Clark, T. , Rodriguez, J.A. , Sauter, N.K. , Sawaya, M.R. , Sierra, R.G. , Uervirojnangkoorn, M. , W Park, H. , Williams, G.J.
Date: 2015-11-26 Method: X-RAY DIFFRACTION Resolution: 2.25 Å Organism(s): Lysinibacillus Sphaericus Sequences Data: 5FOY_A , 5FOY_B
5FOZ
De novo structure of the binary mosquito larvicide binab at ph 10 Deposition Author(s): Bideshi, D.L. , Boutet, S. , Brewster, A.S. , Brunger, A.T. , Cascio, D. , Colletier, J.P. , Deponte, D.P. , Eisenberg, D.S. , Federici, B.A. , Gingery, M. , Hunter, M.S. , Koglin, J.E. , Laksmono, H. , Messerschmidt, M. , Michels-Clark, T. , Rodriguez, J.A. , Sauter, N.K. , Sawaya, M.R. , Sierra, R.G. , Uervirojnangkoorn, M. , W Park, H. , Williams, G.J.
Date: 2015-11-26 Method: X-RAY DIFFRACTION Resolution: 2.4 Å Organism(s): Lysinibacillus Sphaericus Sequences Data: 5FOZ_A , 5FOZ_B
5G37
Mr structure of the binary mosquito larvicide binab at ph 5 Deposition Author(s): Bideshi, D.L. , Boutet, S. , Brewster, A.S. , Brunger, A.T. , Cascio, D. , Colletier, J.P. , Deponte, D.P. , Eisenberg, D.S. , Federici, B.A. , Gingery, M. , Hunter, M.S. , Koglin, J.E. , Laksmono, H. , Messerschmidt, M. , Michels-Clark, T. , Rodriguez, J.A. , Sauter, N.K. , Sawaya, M.R. , Sierra, R.G. , Uervirojnangkoorn, M. , W Park, H. , Williams, G.J.
Date: 2016-04-24 Method: X-RAY DIFFRACTION Resolution: 2.5 Å Organism(s): Lysinibacillus Sphaericus Sequences Data: 5G37_A , 5G37_B
5HA7
Human aldose reductase in complex with nadp+ and wy14643 in space group p212121 Deposition Author(s): Balendiran, G.K. , Cascio, D. , Sawaya, M.R.
Date: 2015-12-30 Method: X-RAY DIFFRACTION Resolution: 1.65 Å Organism(s): Homo Sapiens Sequences Data: 5HA7_A , 5HA7_B
5HAT
Structure function studies of r. palustris rubisco (s59f/m331a mutant; cabp-bound) Deposition Author(s): Arbing, M.A. , Cascio, D. , Leong, J.G. , North, J.A. , Satagopan, S. , Tabita, F.R. , Varaljay, V.A.
Date: 2015-12-30 Method: X-RAY DIFFRACTION Resolution: 2 Å Organism(s): Rhodopseudomonas Palustris Sequences Data: 5HAT_A , 5HAT_B , 5HAT_C , 5HAT_D , 5HAT_E , 5HAT_F , 5HAT_G , 5HAT_H , 5HAT_I , 5HAT_J , 5HAT_K , 5HAT_L
5HJY
Structure function studies of r. palustris rubisco (i165t mutant; cabp-bound) Deposition Author(s): Arbing, M.A. , Cascio, D. , North, J.A. , Satagopan, S. , Shin, A. , Tabita, F.R.
Date: 2016-01-13 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Rhodopseudomonas Palustris Sequences Data: 5HJY_A , 5HJY_B , 5HJY_C , 5HJY_D , 5HJY_E , 5HJY_F
5HK4
Structure function studies of r. palustris rubisco (a47v-m331a mutant) Deposition Author(s): Arbing, M.A. , Cascio, D. , North, J.A. , Satagopan, S. , Shin, A. , Tabita, F.R.
Date: 2016-01-13 Method: X-RAY DIFFRACTION Resolution: 2.15 Å Organism(s): Rhodopseudomonas Palustris Sequences Data: 5HK4_A , 5HK4_B , 5HK4_C , 5HK4_D , 5HK4_E , 5HK4_F
5HQL
Structure function studies of r. palustris rubisco (a47v-m331a mutant; cabp-bound; no expression tag) Deposition Author(s): Arbing, M.A. , Cascio, D. , North, J.A. , Satagopan, S. , Shin, A. , Tabita, F.R.
Date: 2016-01-21 Method: X-RAY DIFFRACTION Resolution: 2.53 Å Organism(s): Rhodopseudomonas Palustris Sequences Data: 5HQL_A , 5HQL_B , 5HQL_C , 5HQL_D , 5HQL_E , 5HQL_F
5HQM
Structure function studies of r. palustris rubisco (r. palustris/r. rubrum chimera) Deposition Author(s): Arbing, M.A. , Cascio, D. , Satagopan, S. , Shin, A. , Tabita, F.R.
Date: 2016-01-21 Method: X-RAY DIFFRACTION Resolution: 1.95 Å Organism(s): Rhodopseudomonas Palustris , Rhodospirillum Rubrum Sequences Data: 5HQM_A , 5HQM_B