Search Query :
5DFM
Structure of tetrahymena telomerase p19 fused to mbp Deposition Author(s): Cascio, D. , Chan, H. , Feigon, J. , Sawaya, M.R.
Date: 2015-08-27 Method: X-RAY DIFFRACTION Resolution: 2.301 Å Organism(s): Escherichia Coli , Tetrahymena Thermophila Sequences Data: 5DFM_A , 5DFM_B
5DFN
Structure of tetrahymena telomerase p45 c-terminal domain Deposition Author(s): Cascio, D. , Chan, H. , Feigon, J. , Sawaya, M.R.
Date: 2015-08-27 Method: X-RAY DIFFRACTION Resolution: 2.382 Å Organism(s): Tetrahymena Thermophila Sequences Data: 5DFN_A , 5DFN_B
5DRK
2.3 angstrom structure of cpii, a nitrogen regulatory pii-like protein from thiomonas intermedia k12, bound to adp, amp and bicarbonate. Deposition Author(s): Cascio, D. , Ngo, J. , Sawaya, M.R. , Wheatley, N.M. , Yeates, T.O.
Date: 2015-09-15 Method: X-RAY DIFFRACTION Resolution: 2.38 Å Organism(s): Thiomonas Intermedia (Strain K12) Sequences Data: 5DRK_A , 5DRK_B , 5DRK_C
5DS7
2.0 a structure of cpii, a nitrogen regulatory pii-like protein from thiomonas intermedia k12, bound amp Deposition Author(s): Cascio, D. , Ngo, J. , Sawaya, M.R. , Wheatley, N.M. , Yeates, T.O.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2 Å Organism(s): Thiomonas Intermedia (Strain K12) Sequences Data: 5DS7_A , 5DS7_B , 5DS7_C
5DS9
Crystal structure of fis bound to 27bp dna f1-8a (aaattagtttgaattttgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.561 Å Organism(s): Escherichia Coli (Strain K12) , Synthetic Construct Sequences Data: 5DS9_A , 5DS9_B , 5DS9_C , 5DS9_D
5DTD
Crystal structure of fis bound to 27bp dna f1-8c (aaattcgtttgaattttgagcgaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-09-17 Method: X-RAY DIFFRACTION Resolution: 2.642 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5DTD_A , 5DTD_B , 5DTD_C , 5DTD_D
5DUD
Crystal structure of e. coli ybgjk Deposition Author(s): Arbing, M.A. , Cascio, D. , Eisenberg, D. , Kaufmann, M. , Medrano-Soto, A. , Shin, A.
Date: 2015-09-18 Method: X-RAY DIFFRACTION Resolution: 2.8 Å Organism(s): Escherichia Coli (Strain K12) Sequences Data: 5DUD_A , 5DUD_C , 5DUD_B , 5DUD_D
5E3L
Crystal structure of fis bound to 27bp dna f1-8g (aaattggtttgaattttgagccaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3L_A , 5E3L_B , 5E3L_C , 5E3L_D
5E3M
Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C. , Stella, S.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.886 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3M_A , 5E3M_B , 5E3M_C , 5E3M_D
5E3N
Crystal structure of fis bound to 27bp dna f31 (aaatttgtaggaattttctgcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.66 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3N_A , 5E3N_B , 5E3N_C , 5E3N_D