Search Query :
4D6O
The crystal structure of i-dmoi in complex with its target dna at 1h incubation in 5mm mg (state 2) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-11-13 Method: X-RAY DIFFRACTION Resolution: 2.2 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4D6O_A , 4D6O_D , 4D6O_G , 4D6O_B , 4D6O_H , 4D6O_C , 4D6O_I , 4D6O_E , 4D6O_F
4UN7
The crystal structure of i-dmoi in complex with its target dna before incubation in 5mm mn (state 1) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.7 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UN7_A , 4UN7_D , 4UN7_B , 4UN7_E , 4UN7_H , 4UN7_C , 4UN7_F , 4UN7_I , 4UN7_G
4UN8
The crystal structure of i-dmoi in complex with its target dna at 1h incubation in 5mm mn (state 2) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.6 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UN8_A , 4UN8_D , 4UN8_B , 4UN8_E , 4UN8_H , 4UN8_C , 4UN8_F , 4UN8_I , 4UN8_G
4UN9
The crystal structure of i-dmoi in complex with its target dna at 8h incubation in 5mm mn (state 3) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.734 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UN9_A , 4UN9_D , 4UN9_B , 4UN9_E , 4UN9_H , 4UN9_C , 4UN9_F , 4UN9_I , 4UN9_G
4UNA
The crystal structure of i-dmoi in complex with its target dna at 2 days incubation in 5mm mn (state 4) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UNA_A , 4UNA_D , 4UNA_G , 4UNA_B , 4UNA_E , 4UNA_H , 4UNA_C , 4UNA_F , 4UNA_I , 4UNA_K , 4UNA_M , 4UNA_O
4UNB
The crystal structure of i-dmoi in complex with its target dna at 6 days incubation in 5mm mn (state 5) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.55 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UNB_A , 4UNB_D , 4UNB_G , 4UNB_B , 4UNB_E , 4UNB_H , 4UNB_C , 4UNB_F , 4UNB_I , 4UNB_J , 4UNB_L , 4UNB_N , 4UNB_K , 4UNB_M , 4UNB_O
4UNC
The crystal structure of i-dmoi in complex with its target dna at 8 days incubation in 5mm mn (state 6) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-05-26 Method: X-RAY DIFFRACTION Resolution: 2.3 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UNC_A , 4UNC_D , 4UNC_G , 4UNC_B , 4UNC_E , 4UNC_H , 4UNC_C , 4UNC_F , 4UNC_I , 4UNC_J , 4UNC_L , 4UNC_N , 4UNC_K , 4UNC_M , 4UNC_O
4UT0
The crystal structure of i-dmoi in complex with its target dna at 10 days incubation in 5mm mn (state 7) Deposition Author(s): Gomez, H. , Marcaida, M.J. , Molina, R. , Montoya, G. , Orozco, M. , Prieto, J. , Redondo, P. , Stella, S.
Date: 2014-07-17 Method: X-RAY DIFFRACTION Resolution: 2.4 Å Organism(s): Desulfurococcus Mobilis , Synthetic Construct Sequences Data: 4UT0_A , 4UT0_F , 4UT0_K , 4UT0_B , 4UT0_G , 4UT0_L , 4UT0_C , 4UT0_H , 4UT0_M , 4UT0_D , 4UT0_I , 4UT0_N , 4UT0_E , 4UT0_J , 4UT0_O
5E3M
Crystal structure of fis bound to 27bp dna f35 (aaattagtttgaatctcgagctaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C. , Stella, S.
Date: 2015-10-03 Method: X-RAY DIFFRACTION Resolution: 2.886 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 5E3M_A , 5E3M_B , 5E3M_C , 5E3M_D
5MGA
Structure of the cpf1 endonuclease r-loop complex after dna cleavage Deposition Author(s): Montoya, G. , Stella, S.
Date: 2016-11-21 Method: X-RAY DIFFRACTION Resolution: 3 Å Organism(s): Francisella Tularensis Subsp. Novicida U112 , Synthetic Construct Sequences Data: 5MGA_A , 5MGA_B , 5MGA_C , 5MGA_D