Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence atgagtcata Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.09 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZG_A , 9YZG_B , 9YZG_C
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence cccggccgga Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 4 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZI_A , 9YZI_B , 9YZI_C
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence cgtaattagg Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 2.97 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZJ_A , 9YZJ_B , 9YZJ_C
Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence acccttctatgacctactcca Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 5.1 Å Organism(s): Escherichia Coli , Synthetic Construct Sequences Data: 9YZK_C , 9YZK_E , 9YZK_F
Isoreticular co-crystal of replication initiator protein repe54 and asymmetrical expanded duplex (31mer) containing the cognate repe54 sequence, and additional t-a rich sequence with 5' terminal phosphates. two copies of even-skipped homeodomain loaded post-crystallization Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.02 Å Organism(s): Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZL_A , 9YZL_B , 9YZL_C , 9YZL_E , 9YZL_D
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ctaattaggc and loaded with even-skipped homeodomain Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.07 Å Organism(s): Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZM_A , 9YZM_B , 9YZM_C , 9YZM_D , 9YZM_E
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with even-skipped homeodomain Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.16 Å Organism(s): Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZN_A , 9YZN_B , 9YZN_C , 9YZN_E , 9YZN_D
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with even-skipped homeodomain Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 2.96 Å Organism(s): Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZO_A , 9YZO_B , 9YZO_C , 9YZO_D , 9YZO_E
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with ultrabithorax homeodomain Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.67 Å Organism(s): Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZP_D , 9YZP_A , 9YZP_B , 9YZP_C
Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence tgatgagcag and loaded with engrailed homeodomain enhanced green fluorescent protein fusion Deposition Author(s): Magna, E.N. , Shields, E.T. , Slaughter, C.K. , Snow, C.D.
Date: 2025-10-30 Method: X-RAY DIFFRACTION Resolution: 3.75 Å Organism(s): Aequorea Victoria , Drosophila Melanogaster , Escherichia Coli , Synthetic Construct Sequences Data: 9YZQ_A , 9YZQ_B , 9YZQ_C , 9YZQ_D