Crystal structure of the c-terminal domain of tetrahymena telomerase protein p65 Deposition Author(s): Cascio, D. , Collins, K. , Feigon, J. , Koo, B.-K. , Patel, A. , Singh, M. , Wang, Z.
Date: 2012-05-01 Method: X-RAY DIFFRACTION Resolution: 2.5 Å Organism(s): Escherichia Coli Mp020980.2 Sequences Data: 4EYT_A , 4EYT_B , 4EYT_C , 4EYT_D , 4EYT_E , 4EYT_F
Crystal structure of the k182r, a183p mutant manganese superoxide dismutase from sacchromyces cerevisiae Deposition Author(s): Cascio, D. , Sheng, Y. , Valentine, J.S.
Date: 2012-05-14 Method: X-RAY DIFFRACTION Resolution: 1.6 Å Organism(s): Bauhinia Forficata Sequences Data: 4F6E_A , 4F6E_B , 4F6E_C , 4F6E_D
Eutl from clostridium perfringens, crystallized under reducing conditions Deposition Author(s): Cascio, D. , Crowley, C.S. , Kopstein, J.S. , Thompson, M.C. , Yeates, T.O.
Date: 2012-05-29 Method: X-RAY DIFFRACTION Resolution: 1.802 Å Organism(s): Vaccinia Virus Copenhagen Sequences Data: 4FDZ_A , 4FDZ_B , 4FDZ_C
Crystal structure of the k184r, l185p mutant manganese superoxide dismutase from candida albicans cytosol Deposition Author(s): Cascio, D. , Sheng, Y. , Valentine, J.S.
Date: 2012-08-29 Method: X-RAY DIFFRACTION Resolution: 1.94 Å Organism(s): Ipomoea Batatas Sequences Data: 4GUN_A , 4GUN_B , 4GUN_C , 4GUN_D , 4GUN_E , 4GUN_F , 4GUN_G , 4GUN_H , 4GUN_I , 4GUN_J , 4GUN_K , 4GUN_L , 4GUN_M , 4GUN_N , 4GUN_O , 4GUN_P
Grpn pentameric microcompartment shell protein from rhodospirillum rubrum Deposition Author(s): Cascio, D. , Gidaniyan, S.D. , Wheatley, N.M. , Yeates, T.O.
Date: 2012-11-30 Method: X-RAY DIFFRACTION Resolution: 3.2 Å Organism(s): Trypanosoma Brucei Gambiense Sequences Data: 4I7A_A , 4I7A_B , 4I7A_C , 4I7A_D , 4I7A_E
Rubidium sites in blood coagulation factor viia Deposition Author(s): Bajaj, S.P. , Cascio, D. , Padmanabhan, K. , Schmidt, A. , Vadivel, K.
Date: 2012-12-08 Method: X-RAY DIFFRACTION Resolution: 1.8 Å Organism(s): N.A. Sequences Data: 4IBL_L , 4IBL_H , 4IBL_T
Crystal structure of fis bound to 27 bp sequence dna f28 (aaatttgtttgagcgttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.716 Å Organism(s): Adineta Vaga , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) Sequences Data: 4IHV_A , 4IHV_B , 4IHV_C , 4IHV_D
Crystal structure of fis bound to 27 bp inosine substituted dna f28-di (aaatttgtttgaicittgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.7 Å Organism(s): Adineta Vaga , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) Sequences Data: 4IHW_A , 4IHW_B , 4IHW_C , 4IHW_D
Crystal structure of fis bound to 27 bp 2-aminopurine substituted dna f28-2ap (aaatttgtttga2t2ttgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.8 Å Organism(s): Adineta Vaga , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) Sequences Data: 4IHX_A , 4IHX_B , 4IHX_C , 4IHX_D
Crystal structure of fis bound to 27bp inosine substituted dna f29-di (aaatttgtttgiicictgagcaaattt) Deposition Author(s): Cascio, D. , Hancock, S.P. , Johnson, R.C.
Date: 2012-12-19 Method: X-RAY DIFFRACTION Resolution: 2.9 Å Organism(s): Adineta Vaga , Rhodobacter Sphaeroides (Strain Atcc 17023 / Dsm 158 / Jcm 6121 / Nbrc 12203 / Ncimb 8253 / Ath 2.4.1.) Sequences Data: 4IHY_A , 4IHY_B , 4IHY_C , 4IHY_D