Search Query :
2KF7
Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution (with g7-to-brg substitution) Deposition Author(s): Amrane, S. , Bouaziz, S. , Lim, K.W. , Luu, K.N. , Mu, Y. , Patel, D.J. , Phan, A.T. , Xu, W.
Date: 2009-02-12 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KF7_A
2KF8
Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by human telomeric repeats in k+ solution Deposition Author(s): Amrane, S. , Bouaziz, S. , Lim, K.W. , Luu, K.N. , Mu, Y. , Patel, D.J. , Phan, A.T. , Xu, W.
Date: 2009-02-12 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KF8_A
2KM3
Structure of an intramolecular g-quadruplex containing a g.c.g.c tetrad formed by human telomeric variant ctaggg repeats Deposition Author(s): Alberti, P. , Guedin, A. , Lacroix, L. , Lim, K.W. , Mergny, J.L. , Phan, A.T. , Riou, J.F. , Royle, N.J.
Date: 2009-07-17 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KM3_A
2KOW
Structure of a two-g-tetrad basket-type intramolecular g-quadruplex formed by giardia telomeric repeat d(taggg)4 in k+ solution (with g18-to-ino substitution) Deposition Author(s): Bouaziz, S. , Hu, L. , Lim, K.W. , Phan, A.T.
Date: 2009-10-02 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KOW_A
2KZD
Structure of a (3+1) g-quadruplex formed by htert promoter sequence Deposition Author(s): Lacroix, L. , Lim, J.K.C. , Lim, J.M.W. , Lim, K.W. , Phan, A.T. , Yue, D.J.E.
Date: 2010-06-16 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KZD_A
2KZE
Structure of an all-parallel-stranded g-quadruplex formed by htert promoter sequence Deposition Author(s): Lacroix, L. , Lim, J.K.C. , Lim, J.M.W. , Lim, K.W. , Phan, A.T. , Yue, D.J.E.
Date: 2010-06-16 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2KZE_A
2LE6
Structure of a dimeric all-parallel-stranded g-quadruplex stacked via the 5'-to-5' interface Deposition Author(s): Do, N.Q. , Heddi, B. , Lim, K.W. , Phan, A.T. , Teo, M.H.
Date: 2011-06-10 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2LE6_A , 2LE6_B
2M8Y
Structure of d[cgcgaagcattcgcg] hairpin Deposition Author(s): Lim, K.W. , Phan, A.T.
Date: 2013-05-30 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2M8Y_A
2M8Z
Structure of d[ggttggcgcgaagcattcgcgggttgg] quadruplex-duplex hybrid Deposition Author(s): Lim, K.W. , Phan, A.T.
Date: 2013-05-30 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2M8Z_A
2M90
Structure of d[gcgcgaagcattcgcggggaggtggggaaggg] quadruplex-duplex hybrid Deposition Author(s): Lim, K.W. , Phan, A.T.
Date: 2013-05-30 Method: SOLUTION NMR Resolution: N.A. Organism(s): N.A. Sequences Data: 2M90_A