9C6U
[d2d3] tensegrity triangle with deazapurine center and helical strands (strands 2+3) with p63 symmetry
PDB DOI: 10.2210/pdb9c6u/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2024-06-09 Deposition Author(s): Galindo, M. , Jong, M. , Lopez-Chamorro, C. , Ohayon, Y. , Sha, R. , Vecchioni, S. , Woloszyn, K.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 5 Å
[d2d3] tensegrity triangle with deazapurine center and helical strands (strands 2+3) with p63 symmetry
Galindo, M. , Jong, M. , Lopez-Chamorro, C. , Ohayon, Y. , Sha, R. , Vecchioni, S. , Woloszyn, K.
Primary Citation of Related Structures: 9C6U
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*(7GU)P*(7DA)P*(7GU)P*CP*(7DA)P*(7GU)P*CP*CP*TP*(7GU)P*TP*(7DA)P*CP*(7GU)P*(7GU)P*(7DA)P*CP*(7DA)P*TP*CP*(7DA))-3') | a | 21 | NA | GAGCAGCCTGTACGGACATCA |
| DNA (5'-D(P*CP*CP*(7GU)P*TP*(7DA)P*CP*(7DA))-3') | b | 7 | NA | CCGTACA |
| DNA (5'-D(P*GP*GP*CP*TP*GP*C)-3') | c | 6 | NA | GGCTGC |
| DNA (5'-D(*TP*CP*TP*GP*AP*TP*GP*T)-3') | d | 8 | NA | TCTGATGT |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2024-06-09 Deposition Author(s): Galindo, M. , Jong, M. , Lopez-Chamorro, C. , Ohayon, Y. , Sha, R. , Vecchioni, S. , Woloszyn, K.