The farfar-md-nmr ensemble of an hiv-1 tar excited state
PDB DOI: 10.2210/pdb8u3m/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2023-09-07 Deposition Author(s): Al-Hashimi, H.M. , Case, D.A. , Ganser, L. , Geng, A. , Pratihar, S. , Roy, R. , Shi, H.
Method: SOLUTION NMR Resolution: N.A.
The farfar-md-nmr ensemble of an hiv-1 tar excited state
Al-Hashimi, H.M. , Case, D.A. , Ganser, L. , Geng, A. , Pratihar, S. , Roy, R. , Shi, H.
Primary Citation of Related Structures: 8U3M
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| The excited state of HIV-1 transactivation response element (31-MER) | a | 31 | NA | GGCAGAUCUGAGCCUUCGGGAGCUCUCUGCC |
Method: SOLUTION NMR
Deposited Date: 2023-09-07 Deposition Author(s): Al-Hashimi, H.M. , Case, D.A. , Ganser, L. , Geng, A. , Pratihar, S. , Roy, R. , Shi, H.