Sequence specific (tgtca) orientation of impypy molecules at a unique minor groove binding site within a self-assembled 3d dna lattice (4x5)
PDB DOI: 10.2210/pdb8tc4/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2023-06-29 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Sequence specific (tgtca) orientation of impypy molecules at a unique minor groove binding site within a self-assembled 3d dna lattice (4x5)
Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Primary Citation of Related Structures: 8TC4
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*AP*TP*GP*TP*CP*AP*C)-3') | a | 21 | NA | GAGCAGACCTGACGATGTCAC |
| DNA (5'-D(P*CP*GP*TP*CP*A)-3') | b | 5 | NA | CGTCA |
| DNA (5'-D(*TP*CP*GP*TP*GP*AP*CP*AP*T)-3') | c | 9 | NA | TCGTGACAT |
| DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3') | d | 7 | NA | GGTCTGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2023-06-29 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.