Sequence specific (aatt) orientation of dapi molecules at a unique minor groove binding site (position1) within a self-assembled 3d dna lattice (4x6)
PDB DOI: 10.2210/pdb8ta9/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2023-06-27 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Sequence specific (aatt) orientation of dapi molecules at a unique minor groove binding site (position1) within a self-assembled 3d dna lattice (4x6)
Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Primary Citation of Related Structures: 8TA9
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*AP*GP*AP*AP*TP*TP*CP*CP*TP*GP*AP*CP*GP*GP*AP*AP*CP*TP*CP*A*(DAP))-3') | a | 21 | NA | GAGAATTCCTGACGGAACTCA |
| DNA (5'-D(P*CP*CP*GP*TP*CP*A)-3') | b | 6 | NA | CCGTCA |
| DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*T)-3') | c | 8 | NA | TCTGAGTT |
| DNA (5'-D(P*GP*GP*AP*AP*TP*TP*C)-3') | d | 7 | NA | GGAATTC |
Method: X-RAY DIFFRACTION
Deposited Date: 2023-06-27 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.