A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology
PDB DOI: 10.2210/pdb8r6d/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2023-11-22 Deposition Author(s): Vianney, Y.M. , Weisz, K.
A quadruplex-duplex hybrid with a three-layered hybrid-2 g-quadruplex topology
Primary Citation of Related Structures: 8R6D
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (31-MER) | a | 31 | NA | GGGCGCGAAGCATTCGCGGGGTTAGGGTGGG |
Method: SOLUTION NMR
Deposited Date: 2023-11-22 Deposition Author(s): Vianney, Y.M. , Weisz, K.