Structure of an i-motif domain with the cytosine analog 1,3-diaza-2-oxophenoxacione (tc) at neutral ph
PDB DOI: 10.2210/pdb8ofc/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2023-03-15 Deposition Author(s): Escaja, N. , Gandioso, A. , Garavis, M. , Gonzalez, C. , Mir, B. , Orozco, M. , Serrano-Chacon, I. , Terrazas, M.
Structure of an i-motif domain with the cytosine analog 1,3-diaza-2-oxophenoxacione (tc) at neutral ph
Escaja, N. , Gandioso, A. , Garavis, M. , Gonzalez, C. , Mir, B. , Orozco, M. , Serrano-Chacon, I. , Terrazas, M.
Primary Citation of Related Structures: 8OFC
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*CP*(YCO)P*GP*TP*TP*CP*(DNR)P*GP*TP*TP*TP*TP*TP*CP*CP*GP*TP*TP*CP*(DNR)P*GP*T)-3') | a | 22 | NA | CXGTTCCGTTTTTCCGTTCCGT |
Method: SOLUTION NMR
Deposited Date: 2023-03-15 Deposition Author(s): Escaja, N. , Gandioso, A. , Garavis, M. , Gonzalez, C. , Mir, B. , Orozco, M. , Serrano-Chacon, I. , Terrazas, M.