Crystal structure of theophylline dna aptamer bound to 3-methylxanthine
PDB DOI: 10.2210/pdb8k0v/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2023-07-10 Deposition Author(s): Huang, L. , Huang, Y. , Lin, X.
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (29-MER) | a | 29 | NA | GCGGTGGTCTATTCATAGGCGTCCGCCGC |
Method: X-RAY DIFFRACTION