Human telomeric dna g-quadruplex of a gold(iii) complex containing the 2,4,6-tris (2-pyrimidyl)-1,3,5-triazine ligand
PDB DOI: 10.2210/pdb7qvq/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2022-01-23 Deposition Author(s): Bazzicalupi, C. , Bergmann, J. , Gratteri, P. , Ryde, U.
Human telomeric dna g-quadruplex of a gold(iii) complex containing the 2,4,6-tris (2-pyrimidyl)-1,3,5-triazine ligand
Bazzicalupi, C. , Bergmann, J. , Gratteri, P. , Ryde, U.
Primary Citation of Related Structures: 7QVQ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human telomeric DNA | a | 24 | NA | TAGGGTTAGGGTTAGGGTTAGGGT |
Method: X-RAY DIFFRACTION
Deposited Date: 2022-01-23 Deposition Author(s): Bazzicalupi, C. , Bergmann, J. , Gratteri, P. , Ryde, U.