G-quadruplex structure of the c. elegans telomeric repeat: a two tetrads basket type conformation stabilised by a hoogsteen c-t base-pair
PDB DOI: 10.2210/pdb7oqt/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2021-06-04 Deposition Author(s): Amrane, S. , De Rache, A. , Marquevielle, J.
G-quadruplex structure of the c. elegans telomeric repeat: a two tetrads basket type conformation stabilised by a hoogsteen c-t base-pair
Amrane, S. , De Rache, A. , Marquevielle, J.
Primary Citation of Related Structures: 7OQT
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*G)-3') | a | 20 | NA | GGCTTAGGCTTAGGCTTAGG |
Method: SOLUTION NMR
Deposited Date: 2021-06-04 Deposition Author(s): Amrane, S. , De Rache, A. , Marquevielle, J.