Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer a
PDB DOI: 10.2210/pdb7n7d/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2021-06-10 Deposition Author(s): Dickerhoff, J. , Yang, D.
Method: SOLUTION NMR Resolution: N.A.
Solution structure of the myc promoter g-quadruplex in complex with berberine: conformer a
Primary Citation of Related Structures: 7N7D
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Myc2345 | a | 22 | NA | TGAGGGTGGGTAGGGTGGGGAA |
Method: SOLUTION NMR
Deposited Date: 2021-06-10 Deposition Author(s): Dickerhoff, J. , Yang, D.