7KLP
Crystal structure of a three-tetrad, parallel, k+ stabilized human telomeric g-quadruplex
PDB DOI: 10.2210/pdb7klp/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-10-30 Deposition Author(s): Chen, E.V. , Li, K.S. , Yatsunyk, L.A.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 1.35 Å
Crystal structure of a three-tetrad, parallel, k+ stabilized human telomeric g-quadruplex
Chen, E.V. , Li, K.S. , Yatsunyk, L.A.
Primary Citation of Related Structures: 7KLP
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| telomeric DNA | a | 22 | NA | AGGGTTAGGGTTAGGGTTAGGG |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2020-10-30 Deposition Author(s): Chen, E.V. , Li, K.S. , Yatsunyk, L.A.