Crystal structure of the pepper aptamer in complex with hbc514
PDB DOI: 10.2210/pdb7eon/pdb
Classification: RNA Organism(s): Synthetic Construct
Deposited: 2021-04-22 Deposition Author(s): Huang, K.Y. , Ren, A.M.
Crystal structure of the pepper aptamer in complex with hbc514
Primary Citation of Related Structures: 7EON
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Pepper (49-MER) | a | 48 | NA | GCGCACUGGCGCUGCGCCUUCGGGCGCCAAUCGUAGCGUGUCGGCGCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2021-04-22 Deposition Author(s): Huang, K.Y. , Ren, A.M.