Crystal structure of sam-i riboswitch with the actinomyces-1 k-turn
PDB DOI: 10.2210/pdb7eaf/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2021-03-07 Deposition Author(s): Huang, L. , Lilley, D.M.J.
Crystal structure of sam-i riboswitch with the actinomyces-1 k-turn
Primary Citation of Related Structures: 7EAF
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (94-MER) | a | 94 | NA | GGCUUAUCAAGAGAGGGCGAGGGACUGGCCCGACGACCCCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG |
Method: X-RAY DIFFRACTION
Deposited Date: 2021-03-07 Deposition Author(s): Huang, L. , Lilley, D.M.J.