Solution structure of an rna derived from the joint region of the tar and polya stems of hiv-1 genomic rna
PDB DOI: 10.2210/pdb7dd4/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2020-10-27 Deposition Author(s): Kawai, G. , Masuda, T. , Obayashi, C.M. , Shinohara, Y.
Solution structure of an rna derived from the joint region of the tar and polya stems of hiv-1 genomic rna
Kawai, G. , Masuda, T. , Obayashi, C.M. , Shinohara, Y.
Primary Citation of Related Structures: 7DD4
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (36-MER) | a | 36 | NA | GGUCUCUCUUCGGGGAACCCACUGCGAAAGUAGUGU |
Method: SOLUTION NMR
Deposited Date: 2020-10-27 Deposition Author(s): Kawai, G. , Masuda, T. , Obayashi, C.M. , Shinohara, Y.