Quadruplex-duplex hybrid structure in the pim1 gene, form 1
PDB DOI: 10.2210/pdb7cv3/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-08-25 Deposition Author(s): Lim, K.W. , Phan, A.T. , Tan, D.J.Y. , Winnerdy, F.R.
Quadruplex-duplex hybrid structure in the pim1 gene, form 1
Lim, K.W. , Phan, A.T. , Tan, D.J.Y. , Winnerdy, F.R.
Primary Citation of Related Structures: 7CV3
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
PIM1 promoter, Form 1 | a | 27 | NA | GCGGGAGGGCGCGCCAGCGGGGTCGGG |
Method: SOLUTION NMR
Deposited Date: 2020-08-25 Deposition Author(s): Lim, K.W. , Phan, A.T. , Tan, D.J.Y. , Winnerdy, F.R.