Structure of a parallel c-myc modified with 5' duplex stem-loop overhang
PDB DOI: 10.2210/pdb6zl9/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-06-30 Deposition Author(s): Vianney, Y.M. , Weisz, K.
Structure of a parallel c-myc modified with 5' duplex stem-loop overhang
Primary Citation of Related Structures: 6ZL9
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (35-MER) | a | 35 | NA | GATCAGTTTTACTGATCGGGTGGGTAGGGTGGGTA |
Method: SOLUTION NMR
Deposited Date: 2020-06-30 Deposition Author(s): Vianney, Y.M. , Weisz, K.