Self-assembly of a 3d dna crystal lattice (4x5 duplex version) containing the j25 immobile holliday junction
PDB DOI: 10.2210/pdb6wt0/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2020-05-01 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Self-assembly of a 3d dna crystal lattice (4x5 duplex version) containing the j25 immobile holliday junction
Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.
Primary Citation of Related Structures: 6WT0
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*AP*GP*CP*AP*GP*AP*CP*GP*AP*GP*AP*CP*CP*GP*CP*AP*CP*TP*CP*A)-3') | a | 21 | NA | GAGCAGACGAGACCGCACTCA |
| DNA (5'-D(P*GP*GP*TP*CP*T)-3') | b | 5 | NA | GGTCT |
| DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*C)-3') | c | 9 | NA | TCTGAGTGC |
| DNA (5'-D(P*CP*GP*TP*CP*TP*GP*C)-3') | d | 7 | NA | CGTCTGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2020-05-01 Deposition Author(s): Macculloch, T. , Simmons, C.R. , Stephanopoulos, N. , Yan, H.