Solution nmr structure of 5'utr stem loop b in denv4 flavivirus.
PDB DOI: 10.2210/pdb6w3m/pdb
Classification: RNA Organism(s): Dengue Virus 4 Philippines/H241/1956
Deposited: 2020-03-09 Deposition Author(s): Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Sharma, S. , Varani, G.
Solution nmr structure of 5'utr stem loop b in denv4 flavivirus.
Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Sharma, S. , Varani, G.
Primary Citation of Related Structures: 6W3M
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (41-MER) | a | 41 | NA | GGUUUGUUUGAAUAGAGAGCAGAUCUCUGGAAAAAUGAACC |
Method: SOLUTION NMR
Deposited Date: 2020-03-09 Deposition Author(s): Seattle Structural Genomics Center For Infectious Disease (Ssgcid) , Sharma, S. , Varani, G.