Crystal structure of a fragment of e. coli trna(asp) consisting of its acceptor stem/t stem-loop. long unit cell.
PDB DOI: 10.2210/pdb6ugi/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2019-09-26 Deposition Author(s): Chan, C.W. , Mondragon, A.
Method: X-RAY DIFFRACTION Resolution: 1.75 Å
Crystal structure of a fragment of e. coli trna(asp) consisting of its acceptor stem/t stem-loop. long unit cell.
Primary Citation of Related Structures: 6UGI
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
tRNA(Asp) acceptor stem/T stem-loop | a | 31 | NA | GGAGCGGGCGGGUUCGAGUCCCGUCCGUUCC |
Method: X-RAY DIFFRACTION
Deposited Date: 2019-09-26 Deposition Author(s): Chan, C.W. , Mondragon, A.