Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet
PDB DOI: 10.2210/pdb6ia4/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2018-11-26 Deposition Author(s): Bielskute, S. , Plavec, J. , Podbevsek, P.
Method: SOLUTION NMR Resolution: N.A.
Human telomeric g-quadruplex with 8-oxo-g substitution in the outer g-quartet
Bielskute, S. , Plavec, J. , Podbevsek, P.
Primary Citation of Related Structures: 6IA4
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| hTel-oxoG21 | a | 24 | NA | TTGGGTTAGGGTTAGGGTTAGGGA |
Method: SOLUTION NMR
Deposited Date: 2018-11-26 Deposition Author(s): Bielskute, S. , Plavec, J. , Podbevsek, P.