Structure of the complex of a human telomeric dna with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i)
PDB DOI: 10.2210/pdb6h5r/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2018-07-25 Deposition Author(s): Bazzicalupi, C. , Gratteri, P. , Papi, F.
Structure of the complex of a human telomeric dna with bis(1-butyl-3-methyl-imidazole-2-ylidene) gold(i)
Bazzicalupi, C. , Gratteri, P. , Papi, F.
Primary Citation of Related Structures: 6H5R
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Human Telomeric DNA | a | 24 | NA | TAGGGTTAGGGTTAGGGTTAGGGT |
Method: X-RAY DIFFRACTION
Deposited Date: 2018-07-25 Deposition Author(s): Bazzicalupi, C. , Gratteri, P. , Papi, F.