5Z80
Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex
PDB DOI: 10.2210/pdb5z80/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2018-01-30 Deposition Author(s): Liu, L.Y. , Liu, W.T. , Mao, Z.W. , Wang, F.Y. , Yang, D.Z. , Zeng, W.J. , Zhong, Y.F.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Solution structure for the 1:1 complex of a platinum(ii)-based tripod bound to a hybrid-1 human telomeric g-quadruplex
Liu, L.Y. , Liu, W.T. , Mao, Z.W. , Wang, F.Y. , Yang, D.Z. , Zeng, W.J. , Zhong, Y.F.
Primary Citation of Related Structures: 5Z80
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| G-quadruplex DNA (26-MER) | a | 26 | NA | AAAGGGTTAGGGTTAGGGTTAGGGAA |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2018-01-30 Deposition Author(s): Liu, L.Y. , Liu, W.T. , Mao, Z.W. , Wang, F.Y. , Yang, D.Z. , Zeng, W.J. , Zhong, Y.F.