5J2W
Intermediate state lying on the pathway of release of tat from hiv-1 tar.
PDB DOI: 10.2210/pdb5j2w/pdb
Classification: VIRAL PROTEIN Organism(s): Human Immunodeficiency Virus 1 , Synthetic Construct
Deposited: 2016-03-30 Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.
Experimental Data Snapshot
Method: SOLUTION NMR Resolution: N.A.
Intermediate state lying on the pathway of release of tat from hiv-1 tar.
Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.
Primary Citation of Related Structures: 5J2W
| Proteins | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Cyclic peptide mimetic of HIV-1 Tat | A | 14 | Human Immunodeficiency Virus 1 , Synthetic Construct | RVRTRKGRRIRIPP |
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| Apical region (29mer) of the HIV-1 TAR RNA element | b | 29 | NA | GGCAGAUCUGAGCCUGGGAGCUCUCUGCC |
Experimental Data
Method: SOLUTION NMR
Deposited Date: 2016-03-30 Deposition Author(s): Bardaro Jr., M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.