PDBi (Protein Data Bank in India)

All in One Protein Databank
Home About Help Resources External Links Contact Us
Advanced Search
FASTA Sequence PDB Format mmCIF Format
FASTA Sequence PDB Format PDB Format(gz) PDBx/mmCIF Format PDBx/mmCIF Format(gz) PDBML/XML Format Validation Full PDF Validation CIF

5J1O

Excited state (bound-like) sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat

PDB DOI: 10.2210/pdb5j1o/pdb

Classification: VIRAL PROTEIN
Organism(s): Human Immunodeficiency Virus 1 , Synthetic Construct

Deposited: 2016-03-29
Deposition Author(s): Bardaro, M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.

Experimental Data Snapshot

Method: SOLUTION NMR
Resolution: N.A.

Literature

Excited state (bound-like) sampled during rdc restrained replica-averaged metadynamics (ram) simulations of the hiv-1 tar complexed with cyclic peptide mimetic of tat

Bardaro, M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.

Primary Citation of Related Structures: 5J1O


Proteins
Molecule Chains Sequence Length Organism Sequence
Cyclic peptide mimetic of Tat A 14 Human Immunodeficiency Virus 1 , Synthetic Construct RVRTRKGRRIRIPP

Nucleic Acids / Hybrid
Molecule Chains Sequence Length Organism Sequence
Apical region (29mer) of the HIV-1 TAR element b 29 NA GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
Experimental Data

Method: SOLUTION NMR

Deposited Date: 2016-03-29
Deposition Author(s): Bardaro, M.F. , Borkar, A.N. , Varani, G. , Vendruscolo, M.