Nmr structure of the 5'-terminal hairpin of the 7sk snrna
PDB DOI: 10.2210/pdb5iem/pdb
Classification: TRANSCRIPTION Organism(s): N.A.
Deposited: 2016-02-25 Deposition Author(s): Bourbigot, S. , Coutant, J. , Dock-Bregeon, A.C. , Kieffer, B. , Lebars, I.
Nmr structure of the 5'-terminal hairpin of the 7sk snrna
Bourbigot, S. , Coutant, J. , Dock-Bregeon, A.C. , Kieffer, B. , Lebars, I.
Primary Citation of Related Structures: 5IEM
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 7SK snRNA | a | 57 | NA | GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGGCUAGGCGGGUCCC |
Method: SOLUTION NMR
Deposited Date: 2016-02-25 Deposition Author(s): Bourbigot, S. , Coutant, J. , Dock-Bregeon, A.C. , Kieffer, B. , Lebars, I.