3dw4 redetermined by direct methods starting from random phase angles
PDB DOI: 10.2210/pdb5d99/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2015-08-18 Deposition Author(s): Mooers, B.H.M.
Method: X-RAY DIFFRACTION Resolution: 0.97 Å
3dw4 redetermined by direct methods starting from random phase angles
Primary Citation of Related Structures: 5D99
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (27-MER) hairpin from sarcin-ricin domain of E. coli 23S rRNA | a | 27 | NA | UGCUCCUAGUACGAGAGGACCGGAGUG |
Method: X-RAY DIFFRACTION
Deposited Date: 2015-08-18 Deposition Author(s): Mooers, B.H.M.