E.coli 23s sarcin-ricil loop, modified with a 2-me on g2661 and a methylphosphonate on a2662
PDB DOI: 10.2210/pdb4y27/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2015-02-09 Deposition Author(s): Ennifar, E. , Fluer, S. , Micura, R.
Method: X-RAY DIFFRACTION Resolution: 0.998 Å
E.coli 23s sarcin-ricil loop, modified with a 2-me on g2661 and a methylphosphonate on a2662
Ennifar, E. , Fluer, S. , Micura, R.
Primary Citation of Related Structures: 4Y27
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| 27-mer 23S Sarcin-Ricil Loop | a | 27 | NA | UGCUCCUAGUACGAGAGGACCGGAGUG |
Method: X-RAY DIFFRACTION
Deposited Date: 2015-02-09 Deposition Author(s): Ennifar, E. , Fluer, S. , Micura, R.