Further refinement of the structure of yeast t-rna-phe
PDB DOI: 10.2210/pdb4tna/pdb
Classification: T-RNA Organism(s): Saccharomyces Cerevisiae
Deposited: 1978-04-12 Deposition Author(s): Brown, R.S. , Hingerty, B.E. , Jack, A.
Further refinement of the structure of yeast t-rna-phe
Brown, R.S. , Hingerty, B.E. , Jack, A.
Primary Citation of Related Structures: 4TNA
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| TRNAPHE | a | 76 | NA | GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA |
Method: X-RAY DIFFRACTION
Deposited Date: 1978-04-12 Deposition Author(s): Brown, R.S. , Hingerty, B.E. , Jack, A.