Crystal structure of an intramolecular human telomeric dna g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3
PDB DOI: 10.2210/pdb4daq/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2012-01-13 Deposition Author(s): Collie, G.W. , Neidle, S.
Crystal structure of an intramolecular human telomeric dna g-quadruplex 21-mer bound by the naphthalene diimide compound bmsg-sh-3
Primary Citation of Related Structures: 4DAQ
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3') | a | 21 | NA | GGGTTAGGGTTAGGGTTAGGG |
Method: X-RAY DIFFRACTION
Deposited Date: 2012-01-13 Deposition Author(s): Collie, G.W. , Neidle, S.