Sam-i riboswitch containing the t. solenopsae kt-23 in complex with s- adenosyl methionine
PDB DOI: 10.2210/pdb4aob/pdb
Classification: TRANSLATION Organism(s): N.A.
Deposited: 2012-03-25 Deposition Author(s): Daldrop, P. , Lilley, D.M.J. , Mcphee, S.A. , Schroeder, K.T.
Sam-i riboswitch containing the t. solenopsae kt-23 in complex with s- adenosyl methionine
Daldrop, P. , Lilley, D.M.J. , Mcphee, S.A. , Schroeder, K.T.
Primary Citation of Related Structures: 4AOB
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| SAM-I RIBOSWITCH | a | 94 | NA | GGCUUAUCAAGAGAGGGCAAGAGACUGGCUUGAUGACCCCCGGCAACCAAAAAUGGUGCCAAUUCCUGCAGAGGAAACGUUGAAAGAUGAGCCA |
Method: X-RAY DIFFRACTION
Deposited Date: 2012-03-25 Deposition Author(s): Daldrop, P. , Lilley, D.M.J. , Mcphee, S.A. , Schroeder, K.T.