3UYH
Crystal structure of an intramolecular human telomeric dna g-quadruplex bound by the naphthalene diimide compound, mm41
PDB DOI: 10.2210/pdb3uyh/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2011-12-06 Deposition Author(s): Collie, G.W. , Neidle, S.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 1.95 Å
Crystal structure of an intramolecular human telomeric dna g-quadruplex bound by the naphthalene diimide compound, mm41
Primary Citation of Related Structures: 3UYH
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human telomeric DNA sequence | a | 22 | NA | AGGGTTAGGGTTAGGGTTAGGG |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2011-12-06 Deposition Author(s): Collie, G.W. , Neidle, S.