3R6R
Structure of the complex of an intramolecular human telomeric dna with berberine formed in k+ solution
PDB DOI: 10.2210/pdb3r6r/pdb
Classification: DNA/ANTIBIOTIC Organism(s): N.A.
Deposited: 2011-03-22 Deposition Author(s): Bazzicalupi, C. , Bilia, A.R. , Ferraroni, M. , Gratteri, P.
Experimental Data Snapshot
Method: X-RAY DIFFRACTION Resolution: 2.4 Å
Structure of the complex of an intramolecular human telomeric dna with berberine formed in k+ solution
Bazzicalupi, C. , Bilia, A.R. , Ferraroni, M. , Gratteri, P.
Primary Citation of Related Structures: 3R6R
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| DNA (22-mer) | a | 22 | NA | AGGGTTAGGGTTAGGGTTAGGG |
Experimental Data
Method: X-RAY DIFFRACTION
Deposited Date: 2011-03-22 Deposition Author(s): Bazzicalupi, C. , Bilia, A.R. , Ferraroni, M. , Gratteri, P.