Regulatory motif from the thymidylate synthase mrna
PDB DOI: 10.2210/pdb3mei/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2010-03-31 Deposition Author(s): Dibrov, S. , Hermann, T. , Mclean, J.
Method: X-RAY DIFFRACTION Resolution: 1.968 Å
Regulatory motif from the thymidylate synthase mrna
Dibrov, S. , Hermann, T. , Mclean, J.
Primary Citation of Related Structures: 3MEI
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP*AP*(5BU)P*GP*CP*CP*UP*GP*UP*GP*GP*CP*GP*G)-3') | a | 23 | NA | CCGCCGCGCCAUGCCUGUGGCGG |
| RNA (5'-R(*CP*CP*GP*CP*CP*GP*CP*GP*CP*CP*AP*(5BU)P*GP*CP*CP*UP*GP*UP*GP*GP*CP*GP*G)-3') | b | 23 | NA | CCGCCGCGCCAUGCCUGUGGCGG |
Method: X-RAY DIFFRACTION
Deposited Date: 2010-03-31 Deposition Author(s): Dibrov, S. , Hermann, T. , Mclean, J.