Crystal structure of the t. tengcongensis sam-i riboswitch variant u34c/a94g bound with sam in manganese chloride
PDB DOI: 10.2210/pdb3gx6/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2009-04-01 Deposition Author(s): Batey, R.T. , Montange, R.K.
Crystal structure of the t. tengcongensis sam-i riboswitch variant u34c/a94g bound with sam in manganese chloride
Primary Citation of Related Structures: 3GX6
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (94-MER) | a | 94 | NA | GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGACGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG |
Method: X-RAY DIFFRACTION
Deposited Date: 2009-04-01 Deposition Author(s): Batey, R.T. , Montange, R.K.