Cation-dependent self-cleavage activity in the duplex form of the subtype-b hiv-1 rna dimerization initiation site
PDB DOI: 10.2210/pdb3far/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2008-11-18 Deposition Author(s): Dumas, P. , Ennifar, E.
Cation-dependent self-cleavage activity in the duplex form of the subtype-b hiv-1 rna dimerization initiation site
Primary Citation of Related Structures: 3FAR
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP*CP*AP*AP*G)-3') | a | 23 | NA | CUUGCUGAAGCGCGCACGGCAAG |
| RNA (5'-R(*CP*UP*UP*GP*CP*UP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP*CP*AP*AP*G)-3') | b | 23 | NA | CUUGCUGAAGCGCGCACGGCAAG |
Method: X-RAY DIFFRACTION
Deposited Date: 2008-11-18 Deposition Author(s): Dumas, P. , Ennifar, E.