Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of [co(nh3)6]cl3 (a1555g mutant, br-derivative)
PDB DOI: 10.2210/pdb3bnt/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.
Method: X-RAY DIFFRACTION Resolution: 2.3 Å
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of [co(nh3)6]cl3 (a1555g mutant, br-derivative)
Primary Citation of Related Structures: 3BNT
Nucleic Acids / Hybrid | ||||
---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Sequence |
A site of human mitochondrial ribosome | a | 22 | NA | CGCGUCACCUCGAGCAAGUCGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.