Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of nonspecifically bound paromomycin (a1555g mutant, br-derivative)
PDB DOI: 10.2210/pdb3bnr/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.
Method: X-RAY DIFFRACTION Resolution: 2.1 Å
Crystal structure of the homo sapiens mitochondrial ribosomal decoding site in the presence of nonspecifically bound paromomycin (a1555g mutant, br-derivative)
Primary Citation of Related Structures: 3BNR
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| A site of human mitochondrial ribosome, chain one | a | 23 | NA | UUGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, chain one | c | 23 | NA | UUGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, chain two | b | 22 | NA | UGCGUCACCUCGAGCAAGUCGC |
| A site of human mitochondrial ribosome, chain three | d | 21 | NA | GCGUCACCUCGAGCAAGUCGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2007-12-14 Deposition Author(s): Kondo, J. , Westhof, E.