Crystal structure of the homo sapiens cytoplasmic ribosomal decoding site in presence of paromamine derivative nb30
PDB DOI: 10.2210/pdb2o3y/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2006-12-02 Deposition Author(s): Baasov, T. , Hainrichson, M. , Kondo, J. , Nudelman, I. , Shallom-Shezifi, D. , Westhof, E.
Method: X-RAY DIFFRACTION Resolution: 2.7 Å
Crystal structure of the homo sapiens cytoplasmic ribosomal decoding site in presence of paromamine derivative nb30
Baasov, T. , Hainrichson, M. , Kondo, J. , Nudelman, I. , Shallom-Shezifi, D. , Westhof, E.
Primary Citation of Related Structures: 2O3Y
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP*UP*CP*GP*C)-3') | a | 23 | NA | UUGCGUCGCUCCGGAAAAGUCGC |
| RNA (5'-R(*UP*UP*GP*CP*GP*UP*CP*GP*CP*UP*CP*CP*GP*GP*AP*AP*AP*AP*GP*UP*CP*GP*C)-3') | b | 23 | NA | UUGCGUCGCUCCGGAAAAGUCGC |
Method: X-RAY DIFFRACTION
Deposited Date: 2006-12-02 Deposition Author(s): Baasov, T. , Hainrichson, M. , Kondo, J. , Nudelman, I. , Shallom-Shezifi, D. , Westhof, E.