Structure of murine tumour necrosis factor alpha cde rna
PDB DOI: 10.2210/pdb2n2o/pdb
Classification: RNA Organism(s): N.A.
Deposited: 2015-05-11 Deposition Author(s): Carlomagno, T. , Codutti, L. , Leppek, K. , Masiewicz, P. , Stoecklin, G. , Windeisen, V. , Zalesak, J.
Structure of murine tumour necrosis factor alpha cde rna
Carlomagno, T. , Codutti, L. , Leppek, K. , Masiewicz, P. , Stoecklin, G. , Windeisen, V. , Zalesak, J.
Primary Citation of Related Structures: 2N2O
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | a | 23 | NA | GCAUGUUUUCUGUGAAAACGGUU |
Method: SOLUTION NMR
Deposited Date: 2015-05-11 Deposition Author(s): Carlomagno, T. , Codutti, L. , Leppek, K. , Masiewicz, P. , Stoecklin, G. , Windeisen, V. , Zalesak, J.