Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
PDB DOI: 10.2210/pdb2mcc/pdb
Classification: DNA Organism(s): N.A.
Deposited: 2013-08-18 Deposition Author(s): Costa, P.J. , Felix, V. , Thomas, J.A. , Williamson, M.P. , Wilson, T.
Structural studies on dinuclear ruthenium(ii) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Costa, P.J. , Felix, V. , Thomas, J.A. , Williamson, M.P. , Wilson, T.
Primary Citation of Related Structures: 2MCC
| Nucleic Acids / Hybrid | ||||
|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Sequence |
| human_telomere_quadruplex | a | 22 | NA | AGGGTTAGGGTTAGGGTTAGGG |
Method: SOLUTION NMR
Deposited Date: 2013-08-18 Deposition Author(s): Costa, P.J. , Felix, V. , Thomas, J.A. , Williamson, M.P. , Wilson, T.